Search⌘ K
AI Features
Home
Courses
Mastering C# for .NET Developers

Solution: DNA Sequence Slicer

Explore how to implement a DNA sequence slicer using C# with ReadOnlySpan for allocation-free memory access and StringBuilder to format sliced sequence output. Understand boundary checks to prevent runtime errors and test varied DNA datasets to handle edge cases and missing markers effectively.

We'll cover the following...
C# 14.0
var analyzer = new DnaAnalyzer();
string dnaData1 = "GATCGTACGATCGATTATACGATCGTAGCTAGCTGAC";
string dnaData2 = "ATCGTATA";
string dnaData3 = "CGTATAGGGGGCCCCCT";
string dnaData4 = "GATCGTACGATCGAT";
Console.WriteLine($"Test 1: {analyzer.ProcessSequence(dnaData1, "TATA")}");
Console.WriteLine($"Test 2: {analyzer.ProcessSequence(dnaData2, "TATA")}");
Console.WriteLine($"Test 3: {analyzer.ProcessSequence(dnaData3, "TATA")}");
Console.WriteLine($"Test 4: {analyzer.ProcessSequence(dnaData4, "GGC")}");
...